• US$350

• 12 designs

• 5 designers

---

Brief de Design Illustration

I would like to have either a hand-drawn or electronic illustration somewhat analogous to the attached illustration of an old iGeekify website. Basically, I want an element like the one that appears to be hand drawn by them, and I plan on embedding it into a website with the text and button elements. The site is a synthetic biology website, so it needs biological overtones to it. I just need the illustration, not an entire web page. The overall size and colors should be analogous to what is in this image. The specific content doesn't have to mean much, but it needs to be turned into DNA letters somehow. One way I've thought to do this would be to put random strings of A,T,C, and G (like ATTACACAAGACGGATACCGG) as a brush stroke in place of the lines in the water, as if the "ship" is floating on a see of DNA sequence. A ship is still fine, a rocket would be nice, a factory would be really appropriate. I'm very open to creative solutions to this. The only real requirements are that it give some hint to being about DNA, it implies going on a journey through a sea of sequence towards some goal, and it has the look and feel of this graphic.

Marché(s) Cible(s)

This is for an academic website. It will principally be viewed by students and other researchers. If it is tempting for you to have a by line on the illustration, I'm happy to include that.

Secteur / Type d'entité

Electronic

---

Aspect

Chaque curseur illustre les caractéristiques de la marque client et le style que doit transmettre votre design de logo.

---

Exigences

Doit avoir

• * Must have some element of DNA sequence in it
  * Must have the look-and-feel of the attached illustration

---

Fichiers